Lecture 8: Patterns, Profiles, and Motifs

• cours magistral

Lecture 8: Patterns, Profiles, and Motifs• Finding patterns in protein and DNA sequences• Calculating profiles of DNA sequences Some slides adapted from slides from Dr. Keith DunkerSome slides adapted from slides created by Dr. Zhiping Weng (Boston University) Definitions and Resources§ Motif: A region of a protein or DNA sequence that may be functionally or structurally significant and/or conserved in other sequences• Motifs usually contain biologically important sequences§ Pattern: Describes a motif using a qualitative consensus sequence (e.

• gal3 cggtccactgtgtgccggal7 cggagcactgttgagcggal80 cggcgcactctcgcccggcy1 cggggcagactattccggal1 cggattagaagccgccgcgggcgacagccctccgcggaagactctcctccggal10 cggaggagagtcttccgcggagggctgtcgcccgcggcggcttctaatccggal2 cggaaagcttccttccgcggcggtctttcgtccgcggagatatctgcgccgcggggcggatcactccgcggatcactccgaaccgpcl10 cggagtatattgcaccgmth1 cggggaaatggagtccg gal4 tata
• test sequence
• dna sequence profile
• pattern
• protein